Consutrction and assembly of time-resolved phylogenetic trees, A tutorial

tutorial

A basic tutorial for building and visualizing time-resolved phylogenetic trees

Author
Affiliation

Elgin Akin

Johns Hopkins University

Published

June 9, 2024

If you would prefer to follow along with the tutorial data and scripts, a clone of this notebook, data and all supporting information is available here. You can make a copy using git but navigating to your desired folder and executing: git clone https://github.com/elginakin/flutreetutorial.

Introduction

Phylogenetic trees are a powerful tool to assess evolutionary relationships between organisms. While this tutorial does not cover the basic principles of viral evolution and ecology, it does provide a quick start guide to constructing, visualizing and annotating static phylogenetic trees using established tools developed and utilized by viral surveillance teams.

If you have already constructed your time tree in either BEAST, IQ-Tree, or TreeTime, you can skip straight to the time tree visualization section

Warning

This tutorial covers the basics of constructing and visualizing time-resolved phylogenetic trees using the H3N2 Influenza A virus as an example. This tutorial is intended for users with a basic understanding of the UNIX command line and R.

H3N2 Tree

Clade Frequency

1. Setting up your environment and directories

Warning

This tutorial assumes you are operating on a machine with a UNIX-based terminal accessible (i.e. macOS, linux or WSL) some of the tools we use are not easily accessible on Windows machines.

Tree Construction

Tree Visualization (R)

  1. We will use the following packages for tree visualization in R. Be sure to install them if you have not already.

Full tutorials for more comprehensive phylognetic analysis pipelines with interactives are descrived in great detail with pathogen-specific tutorials by the Nextstrain Team. - Introduction to Nextstrain - Creating a phylogenetic workflow

Directories

we already have our data directory, go ahead and make 2 directory for our results and config in your home directory.

mkdir results results/plots config config/nextclade config/nextclade/flu_h3n2_ha

2. Accessing and exploring our data from NCBI

For simplicity in this tutorial, we will be accessing sequencing data deposited on NCBI by various groups. At the time of publishing this tutorial, the sequences were accessed from the NCBI Virus Database. In fall of 2024 NCBI will likely redirect the Influenza Virus Resources to NCBI Virus so this step will likely need to be updated for clarity in the near future.

Because these sequences are truly open source they are available in this tutorial and can be downloaded directly from this page:

Note

If you did not clone the tutorial repository, right click the button below to download the data.

This data set include human H3N2 sequences uploaded to NCBI between 2020 and 2024.

Note

We changed the default fasta header template to the following definition for smooth analysis in augur:

{accession}|{strain}|{year}-{month}-{day}|{country}|{segment}

Lets take a quick peek at some information about our fasta. We already know from NCBI that there should be 10191 sequences available to us but lets just check. An incredibly powerful linux tool we can use is grep which you can learn more about here

grep -c  "^>" data/Influenza_virus_database.fa 
10191

10191 Great looks like we have all 10191 sequences.

Next, lets take a peek at our fasta headers. These headers are dennoted as information about our sequence precceed by a “>” and followed by a second line containing our sequencing data. Fasta headers can (theoretically) contain as much information as one pleases as long as it containing in the same line. In common databases such as NCBI Virus, GISAID, the BV-BRC, etc, a lot of information can be included in these headers. Why would one want to do this? Convenience is once answer as metadata complementing sequences can be 1:1 since we do not have to worry about joining these sequences with external metadata (covered at the end of this tutorial).

(If you downloaded data youself, you have likely specified what is included in the header but lets look anyway). By default, NCBI deliminates header information using spaces which is a problem when parsing.

head -10 posts/content/flutree_tutorial/data/Influenza_virus_database.fasta

MT056202|A/California/01/2020|2020-01-02|USA|4 GGATAATTCTATTAACCATGAAGACTATCATTGCTTTGAGCTGCATTCTATGTCTGGTTTTCGCTCAAAA AATTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATA GTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAACTCCTCAATAG GTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGG AGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTCGTTGAACGGAACAAAGCCTACAGC AACTGTTACCCTTATGATGTGCCGGATTATGCATCCCTTAGATCACTAGTTGCCTCATCCGGCACACTGG AGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTTCTTGCACAAGGGG ATCTAAAAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTCCAAATACCCAGCATTAAAC GTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGTGTTCACCACCCGGGTACGGACA`

These sequences have information for 5 attributes (from left to right) seperated by a |. * Accession * Strain Name * Collection Date * Country * Segment

Generating Metadata from fasta headers.

Let generate a metadata table using the information in the .fasta headers using ‘augur parse’.

Download and test augur parse if you gave not already. Augur parse REQUIRES that one attribute in your metadata is named “strain”. Let rename our accession number as “strain” as defined in the fields flag. This will take a second to run since we have so many sequences. We will downsample later in this tutorial.

augur parse \
    --sequences data/Influenza_virus_database.fa \
    --output-sequences results/sequences.fasta \
    --output-metadata results/metadata.tsv \
    --prettify-fields date \
    --fields strain strain_name date country segment

We now have 2 new files, a fasta containing a reduced name representing the strain denotation from augur parse as well as metadata file containing the fields we specified.

It is not uncommon for sequences to uploaded with incomplete date date. In this case, we have 21 sequences which have year-month but not day. Luckily, the nextstrain team is on top of this prviding us with an augur subcommand called curate which we can use to format dates to make them compliant with ISO 8601 dates (YYYY-MM-DD) where missing data are represented with “XX” (e.g. 2021-07- will be converted to 2021-07-XX )

Curate meatadata file dates

augur curate format-dates \
    --metadata results/metadata.tsv \
    --date-fields date \
    --expected-date-formats "%Y-%m-%d" "%Y-%m-" \
    --output-metadata results/dates_metadata.tsv

Great! Our dates are now in a proper format for time-resolved tree construction. If we manually inspect our results dates_metadata.tsv file, we can see that missing days have been replaced with the XX ambiguity for the day.

strain strain_name date country segment
OQ180101 A/WA/39360/2022 2022-11-XX USA 4
OQ180141 A/WA/08914/2022 2022-12-XX USA 4
OQ180149 A/WA/18843/2022 2022-11-XX USA 4
OQ180165 A/WA/27812/2022 2022-12-XX USA 4
OQ180173 A/WA/31872/2022 2022-12-XX USA 4
OQ180181 A/WA/34476/2022 2022-12-XX USA 4
OQ180189 A/WA/38451/2022 2022-11-XX USA 4
OQ180197 A/WA/44633/2022 2022-11-XX USA 4
OQ180205 A/WA/49566/2022 2022-11-XX USA 4
OQ180213 A/WA/49996/2022 2022-11-XX USA 4
OQ180221 A/WA/52234/2022 2022-12-XX USA 4
OQ180229 A/WA/54319/2022 2022-11-XX USA 4
OQ180245 A/WA/57577/2022 2022-12-XX USA 4
OQ180253 A/WA/66184/2022 2022-12-XX USA 4
OQ180261 A/WA/69597/2022 2022-12-XX USA 4
OQ180269 A/WA/75885/2022 2022-12-XX USA 4
Important

If you wish to proceed to constructing phylogenetic trees with amino acid mutations mapped to specific notes, stop here and proceed with the Creating a phylogenetic workflow tutorial. The following steps only provide mutation mapping at the nucleotide level in a time resolved tree.

3. Sequence alignment, feature annotation and clade assignment

This tutorial uses nextclade 3.3.0. Nextclade requires an H3N2 input dataset. We can download a maintained dataset natively through nextclade cli.

nextclade dataset get \
  -n flu_h3n2_ha \
  -o config/nextclade/flu_h3n2_ha
nextclade run \
    --input-dataset=config/nextclade/flu_h3n2_ha/ \
    --output-all=results/ \
    results/sequences.fasta

Join metadata and nextclade results

library(tidyverse)
── Attaching core tidyverse packages ──────────────────────── tidyverse 2.0.0 ──
✔ dplyr     1.2.1     ✔ readr     2.2.0
✔ forcats   1.0.1     ✔ stringr   1.6.0
✔ ggplot2   4.0.3     ✔ tibble    3.3.1
✔ lubridate 1.9.5     ✔ tidyr     1.3.2
✔ purrr     1.2.2     
── Conflicts ────────────────────────────────────────── tidyverse_conflicts() ──
✖ dplyr::filter() masks stats::filter()
✖ dplyr::lag()    masks stats::lag()
ℹ Use the conflicted package (<http://conflicted.r-lib.org/>) to force all conflicts to become errors
metadata = read_tsv('./results/dates_metadata.tsv')
Rows: 10191 Columns: 5
── Column specification ────────────────────────────────────────────────────────
Delimiter: "\t"
chr (4): strain, strain_name, date, country
dbl (1): segment

ℹ Use `spec()` to retrieve the full column specification for this data.
ℹ Specify the column types or set `show_col_types = FALSE` to quiet this message.
nextclade = read_tsv('./results/nextclade.tsv')
Warning: One or more parsing issues, call `problems()` on your data frame for details,
e.g.:
  dat <- vroom(...)
  problems(dat)
Rows: 10191 Columns: 73
── Column specification ────────────────────────────────────────────────────────
Delimiter: "\t"
chr (17): seqName, clade, subclade, short-clade, glycosylation, qc.overallSt...
dbl (34): index, RBD, qc.overallScore, totalSubstitutions, totalDeletions, t...
num  (1): missing
lgl (21): isReverseComplement, deletions, frameShifts, aaDeletions, aaInsert...

ℹ Use `spec()` to retrieve the full column specification for this data.
ℹ Specify the column types or set `show_col_types = FALSE` to quiet this message.
metadata_join = metadata %>% 
    left_join(nextclade, by = c('strain' = 'seqName'))

Lets check to see what metadata we have availible and select accordingly.

colnames(metadata_join) 
 [1] "strain"                                         
 [2] "strain_name"                                    
 [3] "date"                                           
 [4] "country"                                        
 [5] "segment"                                        
 [6] "index"                                          
 [7] "clade"                                          
 [8] "subclade"                                       
 [9] "short-clade"                                    
[10] "RBD"                                            
[11] "glycosylation"                                  
[12] "qc.overallScore"                                
[13] "qc.overallStatus"                               
[14] "totalSubstitutions"                             
[15] "totalDeletions"                                 
[16] "totalInsertions"                                
[17] "totalFrameShifts"                               
[18] "totalMissing"                                   
[19] "totalNonACGTNs"                                 
[20] "totalAminoacidSubstitutions"                    
[21] "totalAminoacidDeletions"                        
[22] "totalAminoacidInsertions"                       
[23] "totalUnknownAa"                                 
[24] "alignmentScore"                                 
[25] "alignmentStart"                                 
[26] "alignmentEnd"                                   
[27] "coverage"                                       
[28] "isReverseComplement"                            
[29] "substitutions"                                  
[30] "deletions"                                      
[31] "insertions"                                     
[32] "frameShifts"                                    
[33] "aaSubstitutions"                                
[34] "aaDeletions"                                    
[35] "aaInsertions"                                   
[36] "privateNucMutations.reversionSubstitutions"     
[37] "privateNucMutations.labeledSubstitutions"       
[38] "privateNucMutations.unlabeledSubstitutions"     
[39] "privateNucMutations.totalReversionSubstitutions"
[40] "privateNucMutations.totalLabeledSubstitutions"  
[41] "privateNucMutations.totalUnlabeledSubstitutions"
[42] "privateNucMutations.totalPrivateSubstitutions"  
[43] "missing"                                        
[44] "unknownAaRanges"                                
[45] "nonACGTNs"                                      
[46] "qc.missingData.missingDataThreshold"            
[47] "qc.missingData.score"                           
[48] "qc.missingData.status"                          
[49] "qc.missingData.totalMissing"                    
[50] "qc.mixedSites.mixedSitesThreshold"              
[51] "qc.mixedSites.score"                            
[52] "qc.mixedSites.status"                           
[53] "qc.mixedSites.totalMixedSites"                  
[54] "qc.privateMutations.cutoff"                     
[55] "qc.privateMutations.excess"                     
[56] "qc.privateMutations.score"                      
[57] "qc.privateMutations.status"                     
[58] "qc.privateMutations.total"                      
[59] "qc.snpClusters.clusteredSNPs"                   
[60] "qc.snpClusters.score"                           
[61] "qc.snpClusters.status"                          
[62] "qc.snpClusters.totalSNPs"                       
[63] "qc.frameShifts.frameShifts"                     
[64] "qc.frameShifts.totalFrameShifts"                
[65] "qc.frameShifts.frameShiftsIgnored"              
[66] "qc.frameShifts.totalFrameShiftsIgnored"         
[67] "qc.frameShifts.score"                           
[68] "qc.frameShifts.status"                          
[69] "qc.stopCodons.stopCodons"                       
[70] "qc.stopCodons.totalStopCodons"                  
[71] "qc.stopCodons.score"                            
[72] "qc.stopCodons.status"                           
[73] "totalPcrPrimerChanges"                          
[74] "pcrPrimerChanges"                               
[75] "failedCdses"                                    
[76] "warnings"                                       
[77] "errors"                                         

Lets select only columns that we would like to include in our tree.

  • Strain_name
  • Date
  • Country
  • Clade
  • Subclade
  • Short-clade
  • glycosylation
  • RBD
metadata_join_filter = metadata_join %>% 
  select(strain,
    strain_name, 
    date, 
    country, 
    clade, 
    subclade, 
    `short-clade`,
    glycosylation, 
    RBD) %>% 
    # write out the metadata final metadata  file
  write_tsv('results/nextclade_metadata.tsv') 

Final downsampling

The file we have downloaded contains too many sequences to be visualized on a single tree. We will downsample to 150 sequences for this tutorial. We can use augur filter to downsample according to attributes such as time of collection sampling to a maximum of 150 sequences.

augur filter \
    --sequences results/sequences.fasta \
    --metadata results/nextclade_metadata.tsv \
    --group-by year month \
    --subsample-max-sequences 150 \
    --output results/downsampled_sequences.fasta \
    --output-metadata results/downsampled_nextclade_metadata.tsv

4. Generating a time tree

We have generated quite a few files at the point in order to filter down our samples.

Realign downsampled sequences

mafft --auto --thread 8 results/downsampled_sequences.fasta > results/downsampled_sequences.aln
treetime \
    --dates results/downsampled_nextclade_metadata.tsv \
    --aln results/downsampled_sequences.aln \
    --outdir results/treetime

5. Visualizing our tree

We will be using ggtree treeio packages developed by Guangchuang Yu.Please be sure it include appropriate citations as requested here.

This tutorial will be using tidyverse packages along with treeio, ggtree and ape

There are many ways to add information to newick and nexus formatted trees. For simplicity, we will be converting our tree into a dataframe for easy data joining before converting back into a tree object.

Required packages

library(tidyverse)
library(treeio)
library(ggtree)
library(ape)

Import time tree

metadata = read_tsv('results/downsampled_nextclade_metadata.tsv')
tree = read.beast('results/treetime/timetree.nexus')

# Convert tree into a dataframe for human readable data joining. 
tree_df = tree %>% as_data_frame() #use treeio

# join the curated metadata with the tree data
tree_df = left_join(tree_df, metadata, by=c("label"="strain"))

# convert dataframe back into phylo data type.
tree_ann = tree_df %>% as.treedata() 

tree_ann
'treedata' S4 object'.

...@ phylo:

Phylogenetic tree with 150 tips and 111 internal nodes.

Tip labels:
  MW024906, MW024914, MT245881, MT467072, MT803253, OP536201, ...
Node labels:
  NODE_0000002, NODE_0000008, NODE_0000006, NODE_0000007, NODE_0000005,
NODE_0000009, ...

Rooted; includes branch length(s).

with the following features available:
  'date.x', 'mutations', 'strain_name', 'date.y', 'country', 'clade',
'subclade', 'short-clade', 'glycosylation', 'RBD'.

# The associated data tibble abstraction: 261 × 13
# The 'node', 'label' and 'isTip' are from the phylo tree.
    node label    isTip date.x  mutations  strain_name  date.y     country clade
   <int> <chr>    <lgl> <chr>   <list>     <chr>        <date>     <chr>   <chr>
 1     1 MW024906 TRUE  2020.5  <chr [1]>  A/Hawaii/28… 2020-07-01 USA     3C   
 2     2 MW024914 TRUE  2020.5  <chr [1]>  A/Hawaii/28… 2020-07-01 USA     3C   
 3     3 MT245881 TRUE  2020.04 <chr [11]> A/Montana/0… 2020-01-15 USA     3C.3…
 4     4 MT467072 TRUE  2020.09 <chr [16]> A/Louisiana… 2020-02-04 USA     3C.3…
 5     5 MT803253 TRUE  2020.2  <chr [6]>  A/Thailand/… 2020-03-13 Thaila… 3C.2…
 6     6 OP536201 TRUE  2020.94 <chr [2]>  A/Saudi Ara… 2020-12-09 Saudi … 3C.2…
 7     7 OP536171 TRUE  2020.94 <chr [1]>  A/Saudi Ara… 2020-12-09 Saudi … 3C.2…
 8     8 MT467091 TRUE  2020.19 <chr [6]>  A/Maryland/… 2020-03-09 USA     3C.2…
 9     9 MT659242 TRUE  2020.12 <chr [2]>  A/Iowa/17/2… 2020-02-12 USA     3C.2…
10    10 MT342264 TRUE  2020.02 <chr [1]>  A/Idaho/05/… 2020-01-07 USA     3C.2…
# ℹ 251 more rows
# ℹ 4 more variables: subclade <chr>, `short-clade` <chr>, glycosylation <chr>,
#   RBD <dbl>

Determine mrsd

Since we have gnerated a tree where the branch lengths are now time resolved, we need to calibrate the date by a reference time for proper scaling by ggtree. The read beast can accept a most recent sampling date (or mrsd) for this calibration. Let’s grab the range of the sequence dates from the metadata file.

metadata %>% 
    summarize(min = min(date), max = max(date))
# A tibble: 1 × 2
  min        max       
  <date>     <date>    
1 2020-01-01 2023-04-10

The mrsd for these data is 2023-04-10. lets proceed with simply plotting the tree along with the time axis.

Ploting a simple tree

Lets take a look at the tree by plotting the minimal tree structure and time scale using theme_tree2(). If all previous steps were completed successfully, we will have a tree along with a time-scaled axis.

# the tree_ann_p will serve as our "base tree" we can add aesthetic elements onto it later to shave down verbose code. 
tree_ann_p <- ggtree(tree_ann,
                      mrsd = '2023-04-10', 
                      right = TRUE) # this "ladderizes" our nodes to be in descending order.

tree_ann_p + theme_tree2() # theme_tree2 will give us our time-scaled axis.

Annotating your tree is the trickiest part of this step. Static trees require the analyst to provide concise information in a way that is simple to interpret. The beauty of ggtree and its spporting packages is that syntax is simple and intuitive making it easy to add information to your tree. Futhermore, its documentation is incrediblely detailed with abundance reproducible examples and explanations for nearly any attribute you would like to add.

Below, I show just one example which best fits only 2 dimensions of information here using tip color and size. However, aesthetics for tip shape as well as for branches can be added as well. It is important that we remember that the tree we have constructed is a down sampled version of our original dataset. Thus, I have included a basic example of a streamgraph from the entire dataset of over 10,000 sequences since we are able to better summarize these data with this visualization.

Plotting an annotated tree

Since H3N2 clade nomenclature is so expansive, lets create a color pallet which can accompany our 23 clades within our dataset. There are dozens of packages which accomplish this beutifully. For this instance, we’ll use the colorspace package and specify the “Set3” palette to expand to our clades. 23 is a very high number to represent in a single plot. However, each clade should cluster discretely assisting with visualization. We will be using the short-clade column for this plot to condense the verbose nomenclature.

Define Color Palette

library(colorspace)
palette = qualitative_hcl(23, palette = "Dark2")
palette
 [1] "#C87A8A" "#C47E79" "#BE8368" "#B58859" "#AA8D4C" "#9C9246" "#8C9747"
 [8] "#799B50" "#649E5E" "#4BA16E" "#2BA37E" "#00A38F" "#00A29E" "#00A0AC"
[15] "#329DB7" "#5598C0" "#7292C5" "#8B8BC7" "#A084C5" "#B17FBF" "#BD7AB5"
[22] "#C478A9" "#C8789B"
# Load required libraries
library(ggplot2)
library(ggtree)
library(grid)

# Define the base plot
tree_ann_p1 <- tree_ann_p + 
  geom_tippoint(aes(fill = factor(`short-clade`), # assigning fill instead of color allows a border
                    size = RBD), # reflect RBD mutations called by nextclade
                alpha = 0.9, # transparency of points
                shape = 21, # empty circle
                stroke = 0.5) + # point border thickness
  scale_size(range = c(0.5, 2)) + 
  xlab("Time") +
  guides(
    fill = guide_legend(title = "Clade", ncol = 2), # customize our legend
    size = guide_legend(title = "RBD Mutations")
  ) +
  theme_tree2( # justify legend 
    legend.position = c(0.40, 0.45),
    axis.text.x = element_text(size = 10), 
    legend.text = element_text(size = 10), 
    legend.spacing.x = unit(0.01, "cm"),
    legend.key.height = unit(0.3, "cm"),
    legend.background = element_rect(fill = "transparent"),
    legend.key = element_rect(fill = "transparent", colour = "transparent") # Make legend key backgrounds transparent
  ) +
  scale_x_continuous( # define x axis labels and breaks
    breaks = seq(2009, 2023, by = 2), 
    labels = seq(2009, 2023, by = 2)
  ) + # define the date increment shown
  scale_fill_manual(values = palette) # Set to our palette for points

# Adding alternating grey and white background for each year
for (year in seq(2008, 2023, by = 1)) {
  tree_ann_p1 <- tree_ann_p1 +
    annotation_custom(
      grob = rectGrob(gp = gpar(fill = ifelse(year %% 2 == 0, 
                                                "grey80", 
                                                "white"), 
                                                col = NA, 
                                                alpha = 0.3)),
      xmin = year, xmax = year + 1, ymin = -Inf, ymax = Inf
    )
}

tree_ann_p1

Lets save our plots and adjust the resolution and size for a “publication-like” figure.

#! echo: false
ggsave('results/plots/h3_tree.png', 
  tree_ann_p1, 
  height = 5, 
  width = 4, 
  dpi = 300)

Plotting Clade Frequency Over Time

Since we have an abundance of metadata for all 10,000 H3N2 isolates, let’s take advantage and plot a [streamgraph] to fully capture the abundance of H3N2 clades over time. We will use the metadata_join dataframe we generated containing nextclade-assigned clades. Again, we face the issue of attempting to visualize 23 clades on one plot. However, the fact that only one or two clades are dominating at any given time will assist with the constraints of many categorical variables. Since we do not have the luxury of discrete clustering as we did with the tree, we can add lines to separate the clades.

knitr::kable(metadata_join %>% 
  select(strain, date, `short-clade`) %>% head(15))
strain date short-clade
MT056202 2020-01-02 3C.3a1
MT105434 2020-01-02 3C.2a1b.2b
MT105458 2020-01-03 3C.2a1b.2
MT168634 2020-01-06 3C.3a1
MT168693 2020-01-01 3C.2a1b.2
MT168702 2020-01-01 3C.2a1b.2
MT168789 2020-01-02 3C.2a1b.2b
MT169082 2020-01-07 3C.2a1b.2a
MT169091 2020-01-07 3C.2a1b.2a
MT169171 2020-01-05 3C.2a1b.1a
MT169188 2020-01-03 3C.2a1b.1a
MT169196 2020-01-08 3C.2a1b.1b
MT169204 2020-01-12 3C.2a1b.1b
MT169212 2020-01-12 3C.2a1b.1b
MT169276 2020-01-02 3C.2a1b.2b

6. Example of a stacked area plot with our abbreviated clade names

library(tidyverse)
library(tidyr)

# Make sure to replace "metadata_join" with the actual name of your dataframe
metadata_join$date = as.Date(metadata_join$date)

clade_count = metadata_join %>% 
  mutate(month = format(date, "%Y-%m")) %>% 
  count(month, `short-clade`) %>% 
  spread(`short-clade`, n, fill = 0)

clade_count_long <- pivot_longer(clade_count, cols = -month, names_to = "short-clade", values_to = "count")

max_dates <- clade_count_long %>%
  group_by(`short-clade`) %>%
  summarize(max_date = max(as.Date(paste0(month, "-01"))))

clade_freq_p <- ggplot(clade_count_long, aes(x = as.Date(paste0(month, "-01")), y = count, fill = `short-clade`)) +
  geom_area(position='stack', linetype=1, size=0.3, color='black') +
  geom_vline(data = data.frame(year = 2015:2023), 
             aes(xintercept = as.Date(paste0(year, "-01-01"))), 
             color = "grey", 
             linetype = "dotted", 
             size = 0.5) +
  labs(x = "Year", y = "Total Sequences \n uploaded to GISAID") +
  theme_bw() + 
  theme(
    legend.position = c(0.30, 0.6),
    axis.text.x = element_text(size = 15), 
    legend.text = element_text(size = 9), 
    legend.spacing.x = unit(0.01, "cm"),
    legend.key.height = unit(0.3, "cm"),
    legend.background = element_rect(fill = "transparent"),
    panel.grid.major = element_blank(),
    panel.grid.minor = element_blank(),
    panel.background = element_rect(fill = "white"),
    panel.border = element_blank(),
    guides(color = guide_legend(title = "Clade", ncol = 2))
  ) +
  scale_x_date(date_breaks = "1 year", date_labels = "%Y") +
  scale_fill_manual(values = palette)  # Set our pre-defined color palette
Warning: Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
ℹ Please use `linewidth` instead.
clade_freq_p
Warning: Removed 23 rows containing non-finite outside the scale range
(`stat_align()`).

ggsave('results/plots/h3_frequency.png', clade_freq_p, height = 3, width = 6, dpi = 300)
Warning: Removed 23 rows containing non-finite outside the scale range
(`stat_align()`).
sessionInfo()
R version 4.6.0 (2026-04-24)
Platform: aarch64-apple-darwin23
Running under: macOS Tahoe 26.5.1

Matrix products: default
BLAS:   /Library/Frameworks/R.framework/Versions/4.6/Resources/lib/libRblas.0.dylib 
LAPACK: /Library/Frameworks/R.framework/Versions/4.6/Resources/lib/libRlapack.dylib;  LAPACK version 3.12.1

locale:
[1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8

time zone: America/New_York
tzcode source: internal

attached base packages:
[1] grid      stats     graphics  grDevices utils     datasets  methods  
[8] base     

other attached packages:
 [1] colorspace_2.1-2 ape_5.8-1        ggtree_4.2.0     treeio_1.36.1   
 [5] lubridate_1.9.5  forcats_1.0.1    stringr_1.6.0    dplyr_1.2.1     
 [9] purrr_1.2.2      readr_2.2.0      tidyr_1.3.2      tibble_3.3.1    
[13] ggplot2_4.0.3    tidyverse_2.0.0 

loaded via a namespace (and not attached):
 [1] gtable_0.3.6            xfun_0.57               htmlwidgets_1.6.4      
 [4] lattice_0.22-9          tzdb_0.5.0              vctrs_0.7.3            
 [7] tools_4.6.0             generics_0.1.4          yulab.utils_0.2.4      
[10] parallel_4.6.0          pkgconfig_2.0.3         ggplotify_0.1.3        
[13] RColorBrewer_1.1-3      S7_0.2.2                lifecycle_1.0.5        
[16] compiler_4.6.0          farver_2.1.2            textshaping_1.0.5      
[19] ggfun_0.2.0             fontquiver_0.2.1        fontLiberation_0.1.0   
[22] htmltools_0.5.9         yaml_2.3.12             lazyeval_0.2.3         
[25] pillar_1.11.1           crayon_1.5.3            MASS_7.3-65            
[28] nlme_3.1-169            fontBitstreamVera_0.1.1 tidyselect_1.2.1       
[31] aplot_0.2.9             digest_0.6.39           stringi_1.8.7          
[34] labeling_0.4.3          fastmap_1.2.0           cli_3.6.6              
[37] magrittr_2.0.5          patchwork_1.3.2         utf8_1.2.6             
[40] withr_3.0.2             gdtools_0.5.1           scales_1.4.0           
[43] rappdirs_0.3.4          bit64_4.8.2             timechange_0.4.0       
[46] rmarkdown_2.31          bit_4.6.0               otel_0.2.0             
[49] ragg_1.5.2              hms_1.1.4               evaluate_1.0.5         
[52] knitr_1.51              gridGraphics_0.5-1      rlang_1.2.0            
[55] ggiraph_0.9.6           Rcpp_1.1.1-1.1          glue_1.8.1             
[58] tidytree_0.4.7          vroom_1.7.1             jsonlite_2.0.0         
[61] R6_2.6.1                systemfonts_1.3.2       fs_2.1.0